aartivnkt/MNM_SelectionTests
Folders and files
| Name | Name | Last commit date | ||
|---|---|---|---|---|
Repository files navigation
README ############################ Simulate alignments with MNMs under empirical conditions ################# BranchSites_MNMSimulations_null.bf is the HYPHY batch file to simulate 50 replicate alignments with MNMs under the BS+MNM null model, using empirically derived parameter estimates This batch file can only be run from the command-line. It executes the following steps: - Take an input alignment file (eg: knownGene.uc001hmo.1.1.testHyPhyBS) - Estimate BS+MNM null model parameters - Simulate 50 replicate alignments, each 5K codon long, using these null model parameters - Write out 50 replicate alignments at this length *Notes i) The example test alignment file is hardcoded in this batch file, and included. ii)Please adjust the path structures to HyPhy library files depending on where the HYPHYMP executable is installed on your machine. iii) This batch file simulates 5K codon long alignments, which are easily amenable to any change (see batch file for directions) Run the batch file as <PATH TO HYPHYMP> BranchSites_MNMSimulations_null.bf ########################### BS+MNM Selection tests ###################################################### HYPHY batch files to run the BS+MNM selection test and estimate k2 under the BS+MNM+k2 model These can only be run from the command-line. i) BranchSites_delta_null.bf: YangNielsenBranchSite Null Model with delta (BS+MNM null) ii) BranchSites_delta_alt.bf: YangNielsenBranchSite Alt Model with delta (BS+MNM alt) ii) BranchSites_delta_kappa2.bf: YangNielsenBranchSiteModel with delta and kappa2 (BS+MNM+k2) Example For BS+MNM Selection tests: <path to HYPHYMP> BranchSites_delta.null.bf <path to HYPHYMP> BranchSites_delta_alt.bf Conduct LRT using chi-square dist, 1 df For BS+MNM+k2 null model estimations: <path to HYPHYMP> BranchSites_delta_kappa2.bf Adjust the path structure depending on where the executable HYPHYMP is installed. Input alignment file should be formatted as you normally would for a HYPHY run, with tree included at the end. Example input alignment file: #hg18 ATGGGCATGAGTAGCTTGAAACTGCTGAAGTATGTCCTGTTTTTCTTCAACTTGCTCTTTTGGATCTGTG #panTro2 ATGGGCATGAGTAGCTTGAAACTGCTGAAGTATGTCCTGTTTTTCTTCAACTTGCTCTTTTGGATCTGTG #rheMac2 ATGGGCATGAGTAGCTTGAAATTGCTGAAGTATGTCCTGTTTTTCTTCAACTTGCTCTTTTGGATCTGTG #mm8 ATGGGCATGAGCAGCCTGAAATTGCTGAAATATGTTCTGTTTATCTTTAACTTGCTTTTTTGGGTCTGTG #rn4 ATGGGCATGAGCAGCCTGAAATTGCTGAAATATGTTCTGTTTTTCTTTAACTTTCTTTTTTGGGTCTGTG #canFam2 ATGGGCATGAGTGGCTTGAAGTTGCTGAAGTACGTTCTGTTTTTCTTCAACTTGCTTTTTTGGTTCTGTG (((hg18, panTro2),rheMac2),(mm8,rn4),canFam2);