hello,Michael
Thanks for your wonderful software.
In recent days, I want to use it for my analysis. I had installed it very well follow your instruction.
$REforge.py -h
usage: REforge.py [-h] [--scorefile SCOREFILE] [--windowsize WINDOWSIZE]
[--background BACKGROUND] [--scrCrrIter SCRCRRITER]
[--no_ancestral_filter] [--no_branch_filter] [--no_fixed_TP]
[--filter_branch_threshold FILTER_BRANCH_THRESHOLD]
[--filter_GC_change FILTER_GC_CHANGE]
[--filter_length_change FILTER_LENGTH_CHANGE]
[--alignment ALIGNMENT] [--verbose] [--debug]
treefile motiffile lossfile elementfile
Analyses transcription factor motifs with respect to their differences in
binding within a phylogeny of CRM sequences and the associated phenotype
positional arguments:
treefile phylogenetic tree given in newick format
motiffile wtmx file containing all transcription factor motifs
lossfile file listing trait loss species; one line per species
elementfile file listing putative elements; one line per fasta
file (.fa or .fasta)
optional arguments:
-h, --help show this help message and exit
--scorefile SCOREFILE
name of score file
--windowsize WINDOWSIZE, -w WINDOWSIZE
windowsize to be used for element scoring
--background BACKGROUND, -bg BACKGROUND
background file - passed into the score function
--scrCrrIter SCRCRRITER
corrects stubb score with average score of <number> of
shuffled sequences. Default is 10
--no_ancestral_filter
elements not are filtered if the ancestral element
scores <= 0
--no_branch_filter branches are not filtered if start and end score <=
filter_branch_threshold
--no_fixed_TP Stubb's transition probablities are not fixed on the
ancestral sequence
--filter_branch_threshold FILTER_BRANCH_THRESHOLD
Default is 0
--filter_GC_change FILTER_GC_CHANGE
if set, branches with a GC content change above the
threshold are filtered
--filter_length_change FILTER_LENGTH_CHANGE
if set, branches with a relative length change above
the threshold are filtered
--alignment ALIGNMENT
--verbose, -v
--debug, -d
But, I met some warnings when running the example test.
WARNING:root:Error in score_sequence_with_stubb: Command 'stubb_noPseudoCount CTGCTCCTTTTGCGTCTACTAAGAAGTTACTTATGTAACATGTTACATCGGGACTTGTTGGCCGTAAGTCGTTGAATGCTGGTACTATTAGGTGTCCTGCGATATTCACTAACGCGTTGAGGCACATCCAATCACAGCTGCATTCCCGACAGTCTGACACCGTCAATTAAGAATGTCACGTGAGGGCACCT data/motifs.wtmx 200.0 1 -b /Bio/home/Yanglab/Yuzhenpeng/opt/biosoft/REforge/example/background//gc0.47/gc0.47.fa -brief -seq' returned non-zero exit status 1.
WARNING:root:Error in score_sequence_with_stubb: Command 'stubb_noPseudoCount ATACTCCTTATAAGTTCCTCTTGTACTCATATGCTCTGACAGTGGCTCAATTGTTTTCGGGCCTTCATAAATGGCAGATATGCAGGGGCCCGACCTATTAAACCTAGTTTAGACCCGAAGAGCACGAATGGCGCATCCGTGGCTTCACAAGATAGGTAGTTGTTAACGGGTCTACTGTCCTATTCGCGCTA data/motifs.wtmx 200.0 1 -b /Bio/home/Yanglab/Yuzhenpeng/opt/biosoft/REforge/example/background//gc0.47/gc0.47.fa -brief -seq' returned non-zero exit status 1.
WARNING:root:Error in score_sequence_with_stubb: Command 'stubb_noPseudoCount CTACTTTGCACGTTACGCTCGCCAGTAATAGTGGATGACAGAAGCCTCTAGAGCAGTTTAGTCGCCCAATCTGAAACAGAACGTAACATTCTCTTGGAGGGTCGGGTTCTTCGACATCTCGAAATGGTGTACCATGTATCTATTACTAGGCCATCCGCATGTCGAATTTATACTACCCTGGTTGTGTCGCT data/motifs.wtmx 200.0 1 -b /Bio/home/Yanglab/Yuzhenpeng/opt/biosoft/REforge/example/background//gc0.47/gc0.47.fa -brief -seq' returned non-zero exit status 1.
Traceback (most recent call last):
File "/Bio/home/Yanglab/Yuzhenpeng/opt/biosoft/REforge/REforge_branch_scoring.py", line 172, in <module>
sys.exit(__score_branches())
File "/Bio/home/Yanglab/Yuzhenpeng/opt/biosoft/REforge/REforge_branch_scoring.py", line 165, in __score_branches
anc0filter=not args.no_ancestral_filter)
File "/Bio/home/Yanglab/Yuzhenpeng/opt/biosoft/REforge/REforge_branch_scoring.py", line 95, in traverse_tree
scrCrrIter=scrCrrIter, keepFiles=True)
File "/Bio/home/Yanglab/Yuzhenpeng/opt/biosoft/REforge/Scoring_utilities.py", line 184, in score_sequence_with_stubb
if scrCrrMthd: assert r_score == 0
AssertionError
Could you give me some help.
Thank you.
hello,Michael
Thanks for your wonderful software.
In recent days, I want to use it for my analysis. I had installed it very well follow your instruction.
But, I met some warnings when running the example test.
Could you give me some help.
Thank you.