Skip to content

Latest commit

 

History

History
176 lines (102 loc) · 7.06 KB

File metadata and controls

176 lines (102 loc) · 7.06 KB

BaseCap

==============

BaseCap.py is a read QC workflow to process sanger sequences.

Background

In both first generation and next generation sequencing methods (NGS) DNA bases are assigned a quality score, known as a Phred score, by base caller programs that analyse the output from sequencing machines. In Sanger sequencing Phred quality scores are assigned based on peak spacing, peak resolution and peak ratios from sequence chromatograms. As a result the quality of a sequence can be assessed by eye when viewing the sequence chromatogram.

Example of a sanger sequence chromatogram:
image

Image taken from here: https://www.azenta.com/blog/analyzing-sanger-sequencing-data


Phred scores, also known as Q scores, represent the probability of an error in the assigned base and are defined by the equation below:

  Q = - 10 log10 Pr (observed allele ≠ true allele)

Phred quality scores above 20 represent a 1% chance a base has been called incorrectly and indicate 99% accuracy in the called base. Generally, bases with a phred or Q score < 20 are likely to have a weak signal and/or high noise. Many read filtering pipelines use this threshold to initially remove low scoring reads from a dataset. In addition, to improve sequence quality and increase read-length, amplicons are usually sequenced bi-directionally using a forward and reverse primer, and merged to a final product.




Problem:

  • In sanger read QC pipelines usually only low scoring bases are trimmed from the sequence ends, but information on the low scoring bases within the sequence are lost.
  • This information is important as a single low scoring base could be mis-interpreted as an SNP.
  • if we are scanning 100+ sequences we do not want to manually go through the chromatograms to assess each suspected SNP.


Solution:

To solve this BaseCap performs the following:

  • Incorporates the standard end trimming recommendations from tracetuner.
  • Indexes quality scores whilst trimming ends and identifying primer sequence.
  • Determines the best place to trim to minimise sequence loss.
  • Capitalises bases below a phred score threshold in the fasta sequence.
  • Outputs a .qual file associated with the trimmed fasta file so that you can merge with phred scores information in CAP3.


Score indexing:

The logic of score indexing is illustrated below:




Usage

BaseCap.py is run on the commandline and takes 3 arguments:

  1. Directory of phd files.

  2. Primer sequence file.

  3. Phred score threshold.

          BaseCap.py phd_directory primer_sequence score_threshold
    

The primer sequences should be in a text file in fasta format, as shown in the example below:

>F
cggagcatgtaccaaaaatac
>R
tcgttttaacttacttcagagt

The following dependancies are required:
*Python3+
*sys
*regex
*os




Read QC Workflow

The pipeline basecap.sh uses exonerate to filter out contaminant reads by aligning to a protein reference sequence, tracetuner for basecalling sanger reads, BaseCap.py for QC trimming and generation of trimmed .qual files, CAP3 for merging and capper.py to capitalise the low scoring bases in the final merged contigs. Contigs are finally aligned using mafft.

A note on TraceTuner commands
Trace tuner is called with the -recalln to reduce the affect of miscalled bases, heterogenous base calls can also be called by ttuner *note the version of BaseCap published here does not include assesing het base calls (please refer to the thesis for further info).

Test files
If you want to try out the entire workflow there are test files available for:

  • ab1 files.
  • phd.1 files.
  • primer sequence.
  • Reference protein.




Example output:

Summary table
The summary table is in csv format and gives information such as:

1.Was the read trimmed (0 or 1)?
2.Trimming positions (start and stop).
3.The length of the read before and after trimming.
4.If the primer sequence was found in the read sequence.

        ID,trimmed(0/1),trim_start,trim_stop,read_len,trimmed_read_len,primer_hit
        SL-CD63-12h_R_069_L18,0,0,168,168,168,0,168,None
        SL-CD63-12e_F_075_E18,1,23,331,357,308,23,342,agtatttttgggacatgactccg
        SL-CD63-12h_F_069_K18,0,0,5,5,5,0,5,None
        SL-CD63-12a_F_052_M16,1,34,355,373,321,34,355,None
        SL-CD63-12e_R_075_F18,1,19,319,320,300,19,319,None
        SL-CD63-12a_R_052_N16,1,30,232,243,202,30,232,None
        SL-CD63-12d_R_077_D18,1,35,323,324,288,35,323,None
        SL-CD63-12d_F_077_C18,1,21,329,354,308,21,343,caagtatttttggtacatgctccg




Viewing capitalised bases in sequences

With low scoring bases capitalised we can now make a more informed decision about our SNPs by viewing sequences them in an alignment viewer. If our SNPs represent real variation they will likely be in lower case, if they are a result of sequencing errors we should see them in uppercase.

(A) illustrates we have alleleic variation and the low scoring base G is more likely to represent real variation. So it could just be a little noisy and that may be in part due to the existance of alternative alleles eg the individual sequence may be heterogenous.
In (B) we see an SNP T within a region of low scoring bases that looks more likely to be a sequencing artefact.

alt text




Citation

If you use this program in your work please cite as:

Eldridge, C.J.L, Majoros, G., Cook, R.T., Kidd, D., Emery, A.M., Lawton, S.P. (2021). BaseCap: A read QC program for Sanger reads [Software]. Unpublished.

If you use the pipeline in your work, please also cite the authors of these tools:

TraceTuner
G.A.Denisov, A.B.Arehart and M.D.Curtin (2004). A system and method for improving the accuracy of DNA sequencing and error probability estimation through application of a mathematical model to the analysis of electropherograms. US Patent 6681186.

CAP3
Huang, X. and Madan, A. (1999) CAP3: A DNA sequence assembly program. Genome Res., 9, 868-877.







Shield: CC BY 4.0

This work is licensed under a Creative Commons Attribution 4.0 International License.

CC BY 4.0